pCAGGS-HA Information

Promoter: CAG promoter

Replicator: SV40 ori, ori

Plasmid classification: lactation serial plasmid; lactation expression plasmid; pCAG series plasmid.

Plasmid size: 4807bp

Prokaryotic resistance: ampicillin Amp (100 u g/ml)

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Expression host: mammalian cells such as 293T

Culture conditions: 37 C, 5%CO2

Induction mode: no induction

5'sequencing primers: pcaggs-F (GCTAACCATGTTCATGCCTTCT)

3'sequencing primers: pcaggs-R (TATGTCCTTCCGAGTGAGAG)

pCAGGS-HA Description

pCAGGS-HA is added with HA tag on the basis of pCAGGS vector, which is helpful to detect antibody in WB test. pCAGGS-HA plasmid is useful for highly efficient expression of genes under the control of the AG promoter and the human CMV-IE enhancer in various mammalian cells.The AG promoter sequence consists of the chicken β-actin promoter, the first exon and part of the first intron (that seems to have a strong enhancer-like activity) linked to a rabbit β-globin fragment, consisting of a 3' part of the second intron (inclusive a branch point which is required for normal splicing reactions) and a 5' part of the third exon.When cloning a fragment downstream from the lac promoter it may be advisable to use lacIq strains in order to prevent fortuitous expression of a possibly noxious polypeptide.